|
Left Crispr |
Right Crispr |
Crispr ID |
1126589184 |
1126589188 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
15:50322429-50322451
|
15:50322460-50322482
|
Sequence |
CCAGCTACTCAGGAGGCTAAGGC |
CACTTGAATCAAGGAGATGGAGG |
Strand |
- |
+ |
Off-target summary |
{0: 2931, 1: 92302, 2: 198207, 3: 231078, 4: 156316} |
{0: 1, 1: 59, 2: 1271, 3: 12760, 4: 48763} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|