|
Left Crispr |
Right Crispr |
| Crispr ID |
1126611737 |
1126611741 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
15:50536870-50536892
|
15:50536908-50536930
|
| Sequence |
CCCAACTTGATCTGTAAATACAA |
AATCCCAGCAACTTATTTTGTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 2, 2: 25, 3: 200, 4: 909} |
{0: 2, 1: 66, 2: 164, 3: 268, 4: 490} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|