ID: 1126645265_1126645267

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1126645265 1126645267
Species Human (GRCh38) Human (GRCh38)
Location 15:50869320-50869342 15:50869342-50869364
Sequence CCATTTGTACAATTTGGATAAAT TGGAGTCAATGCAGAACTGCTGG
Strand - +
Off-target summary No data {0: 1, 1: 2, 2: 1, 3: 15, 4: 136}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!