ID: 1126657750_1126657754

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1126657750 1126657754
Species Human (GRCh38) Human (GRCh38)
Location 15:50998295-50998317 15:50998328-50998350
Sequence CCACTGACCAGAGCAAAAATTCC TGTGCTTTAGAATCACCTGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 159} {0: 1, 1: 2, 2: 21, 3: 152, 4: 603}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!