ID: 1126691571_1126691580

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1126691571 1126691580
Species Human (GRCh38) Human (GRCh38)
Location 15:51292861-51292883 15:51292905-51292927
Sequence CCTTTAGTGGACACAGGTCTGGT ATTCTCTGCTTGGCATTGAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 229} {0: 1, 1: 0, 2: 1, 3: 10, 4: 186}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!