ID: 1126742887_1126742889

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1126742887 1126742889
Species Human (GRCh38) Human (GRCh38)
Location 15:51796020-51796042 15:51796050-51796072
Sequence CCTGCTTGGTCAACTTTATTCTT GTTGGTTTTCTTAAAATGTCTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 5, 3: 105, 4: 821} {0: 1, 1: 0, 2: 2, 3: 34, 4: 355}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!