ID: 1126743203_1126743211

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1126743203 1126743211
Species Human (GRCh38) Human (GRCh38)
Location 15:51799132-51799154 15:51799148-51799170
Sequence CCCTGCTCCTCTGGCCATGGGGA ATGGGGAAGGGTCTGTGATGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 32, 4: 287} {0: 1, 1: 0, 2: 5, 3: 22, 4: 431}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!