ID: 1126752791_1126752795

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1126752791 1126752795
Species Human (GRCh38) Human (GRCh38)
Location 15:51894376-51894398 15:51894403-51894425
Sequence CCTGCCACTGTCCCATCTCAAAA AAATAAAACCTGTTTTTTTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 31, 4: 285} {0: 1, 1: 0, 2: 9, 3: 92, 4: 1101}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!