ID: 1126761168_1126761176

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1126761168 1126761176
Species Human (GRCh38) Human (GRCh38)
Location 15:51971519-51971541 15:51971540-51971562
Sequence CCATCCTGCCCGCCGGAGGAGGA GATGGCACCTCCGGGAGTGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 141} {0: 1, 1: 0, 2: 0, 3: 11, 4: 118}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!