ID: 1126762408_1126762413

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1126762408 1126762413
Species Human (GRCh38) Human (GRCh38)
Location 15:51981159-51981181 15:51981181-51981203
Sequence CCAATATGCTTCCTATGAAAATT TCAGACTTATCGGCCGGGTGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 40, 4: 325} {0: 1, 1: 0, 2: 0, 3: 32, 4: 279}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!