|
Left Crispr |
Right Crispr |
| Crispr ID |
1126763780 |
1126763786 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
15:51993280-51993302
|
15:51993315-51993337
|
| Sequence |
CCAAATATTAGAACAAAAGATCC |
TATTGCTCAGGAAATTAGAAGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 2, 1: 48, 2: 95, 3: 155, 4: 362} |
{0: 1, 1: 4, 2: 28, 3: 107, 4: 453} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|