ID: 1126773607_1126773614

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1126773607 1126773614
Species Human (GRCh38) Human (GRCh38)
Location 15:52080955-52080977 15:52081003-52081025
Sequence CCAGATTATGTTCTGTAAGTACT ATTCTAGTCTGGGGCAGCAAAGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 1, 3: 9, 4: 117}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!