ID: 1126780294_1126780301

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1126780294 1126780301
Species Human (GRCh38) Human (GRCh38)
Location 15:52133906-52133928 15:52133929-52133951
Sequence CCAAATGGAGCAGCCGAGAGTCC CAGCTTTGTTTTGGTGTATGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 80} {0: 1, 1: 0, 2: 0, 3: 27, 4: 251}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!