ID: 1126795787_1126795802

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1126795787 1126795802
Species Human (GRCh38) Human (GRCh38)
Location 15:52259806-52259828 15:52259852-52259874
Sequence CCACCTGGGTGCAAGTCCAACAG CTCCCCAGGAGGCAGCAGCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 138} {0: 1, 1: 0, 2: 5, 3: 81, 4: 762}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!