ID: 1126817229_1126817236

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1126817229 1126817236
Species Human (GRCh38) Human (GRCh38)
Location 15:52466053-52466075 15:52466084-52466106
Sequence CCCCTTCTAAGCCCTAGATCTAA GCAGCCAGGAGACTGTGAGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 137} {0: 1, 1: 2, 2: 13, 3: 48, 4: 423}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!