ID: 1126817234_1126817239

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1126817234 1126817239
Species Human (GRCh38) Human (GRCh38)
Location 15:52466065-52466087 15:52466108-52466130
Sequence CCTAGATCTAACATGCGGAGCAG ACTGCTTGAGGAAGTATCCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 53} {0: 1, 1: 0, 2: 1, 3: 12, 4: 105}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!