ID: 1126855684_1126855685

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1126855684 1126855685
Species Human (GRCh38) Human (GRCh38)
Location 15:52837234-52837256 15:52837250-52837272
Sequence CCTGTCTGACTGCTTGAGTAGGA AGTAGGACATTAATCTTTCCTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 18, 4: 216}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!