ID: 1126856196_1126856203

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1126856196 1126856203
Species Human (GRCh38) Human (GRCh38)
Location 15:52841738-52841760 15:52841784-52841806
Sequence CCAAGTGTGTAATGGTGGGAAGA CAGTGAATCTGGAGAGCAGCAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 4, 3: 32, 4: 289}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!