ID: 1126892616_1126892618

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1126892616 1126892618
Species Human (GRCh38) Human (GRCh38)
Location 15:53222637-53222659 15:53222664-53222686
Sequence CCCTGGTGCAGGCTTAGCAACTC CTAGATAAGCACATTTATCTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 99} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!