|
Left Crispr |
Right Crispr |
| Crispr ID |
1126997449 |
1126997451 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
15:54461367-54461389
|
15:54461381-54461403
|
| Sequence |
CCAAAACACTACTGGTCCCTAGC |
GTCCCTAGCATTTTAGATAAGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 4, 2: 166, 3: 304, 4: 449} |
{0: 1, 1: 29, 2: 356, 3: 805, 4: 901} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|