ID: 1127026721_1127026723

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1127026721 1127026723
Species Human (GRCh38) Human (GRCh38)
Location 15:54815112-54815134 15:54815125-54815147
Sequence CCAGCTACAGGGGCTGTACCCTG CTGTACCCTGCAAAACCACAGGG
Strand - +
Off-target summary No data {0: 49, 1: 1004, 2: 1546, 3: 1300, 4: 1075}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!