|
Left Crispr |
Right Crispr |
Crispr ID |
1127074510 |
1127074522 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
15:55312190-55312212
|
15:55312237-55312259
|
Sequence |
CCCTGCTGGATCCGGAGGGATGG |
CGGCAAACAACAGGGGTGGACGG |
Strand |
- |
+ |
Off-target summary |
{0: 20, 1: 71, 2: 130, 3: 138, 4: 219} |
{0: 1, 1: 3, 2: 67, 3: 131, 4: 179} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|