|
Left Crispr |
Right Crispr |
| Crispr ID |
1127074514 |
1127074522 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
15:55312201-55312223
|
15:55312237-55312259
|
| Sequence |
CCGGAGGGATGGAAGTCAGCGGC |
CGGCAAACAACAGGGGTGGACGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 22, 1: 88, 2: 109, 3: 75, 4: 146} |
{0: 1, 1: 3, 2: 67, 3: 131, 4: 179} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|