ID: 1127085434_1127085436

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1127085434 1127085436
Species Human (GRCh38) Human (GRCh38)
Location 15:55420156-55420178 15:55420175-55420197
Sequence CCTGGAGAAGATAAAGCTAAATC AATCAAAAGAAGGCTATTCTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 22, 4: 220} {0: 1, 1: 0, 2: 4, 3: 33, 4: 269}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!