|
Left Crispr |
Right Crispr |
| Crispr ID |
1127088995 |
1127088996 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
15:55448083-55448105
|
15:55448121-55448143
|
| Sequence |
CCATCAATATCTAGCTTACTGAG |
GTGCTGTTGAATTTTGTCAAAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 31, 2: 487, 3: 3648, 4: 9980} |
{0: 120, 1: 2127, 2: 6333, 3: 3633, 4: 2293} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|