|
Left Crispr |
Right Crispr |
| Crispr ID |
1127132663 |
1127132669 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
15:55883281-55883303
|
15:55883301-55883323
|
| Sequence |
CCACGGAGAGACTCTGCCTGTGG |
TGGAAAGAGAAGGGAAGAGTGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 0, 2: 2, 3: 13, 4: 175} |
{0: 3, 1: 28, 2: 176, 3: 506, 4: 1989} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|