ID: 1127134024_1127134026

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1127134024 1127134026
Species Human (GRCh38) Human (GRCh38)
Location 15:55900184-55900206 15:55900198-55900220
Sequence CCAGTGGGACACAGCAGGACTCC CAGGACTCCAAGGTGACAACAGG
Strand - +
Off-target summary {0: 2, 1: 1, 2: 74, 3: 2314, 4: 31672} {0: 1, 1: 0, 2: 1, 3: 13, 4: 132}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!