ID: 1127159655_1127159661

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1127159655 1127159661
Species Human (GRCh38) Human (GRCh38)
Location 15:56168661-56168683 15:56168688-56168710
Sequence CCTAGTTCCACTTGCAGGTAGGG CCATGTTGACATTACTCTGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 147} {0: 1, 1: 0, 2: 0, 3: 5, 4: 108}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!