|
Left Crispr |
Right Crispr |
| Crispr ID |
1127173563 |
1127173572 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
15:56328860-56328882
|
15:56328902-56328924
|
| Sequence |
CCACCCTGAAGAGAAGGACAGAC |
CTGCTGATTGTAGAGTCCTAGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 0, 2: 18, 3: 124, 4: 383} |
{0: 7, 1: 72, 2: 238, 3: 374, 4: 509} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|