ID: 1127175545_1127175550

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1127175545 1127175550
Species Human (GRCh38) Human (GRCh38)
Location 15:56351503-56351525 15:56351534-56351556
Sequence CCACCCAAGAGCTCGAGTGCAGC CAGTATCTGCATATTGTGTAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 109} {0: 1, 1: 0, 2: 2, 3: 11, 4: 201}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!