ID: 1127175547_1127175550

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1127175547 1127175550
Species Human (GRCh38) Human (GRCh38)
Location 15:56351507-56351529 15:56351534-56351556
Sequence CCAAGAGCTCGAGTGCAGCCAGT CAGTATCTGCATATTGTGTAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 222} {0: 1, 1: 0, 2: 2, 3: 11, 4: 201}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!