ID: 1127194670_1127194673

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1127194670 1127194673
Species Human (GRCh38) Human (GRCh38)
Location 15:56570762-56570784 15:56570782-56570804
Sequence CCAAACAAACTTTAAAGCAACAG CAGCAGTTAAAAAGGACAAAGGG
Strand - +
Off-target summary No data {0: 1, 1: 11, 2: 34, 3: 73, 4: 608}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!