ID: 1127209688_1127209691

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1127209688 1127209691
Species Human (GRCh38) Human (GRCh38)
Location 15:56760382-56760404 15:56760411-56760433
Sequence CCAGAGCATTTTTAGGTAAGCTG GGGAGCTCAAACATGCTTGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 94} {0: 1, 1: 0, 2: 0, 3: 7, 4: 110}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!