ID: 1127209992_1127209996

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1127209992 1127209996
Species Human (GRCh38) Human (GRCh38)
Location 15:56764303-56764325 15:56764353-56764375
Sequence CCTGCTATACACTCATAGATGTT GTTTTGGTTTTGGTTTTTGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 109} {0: 2, 1: 7, 2: 57, 3: 441, 4: 2305}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!