ID: 1127236628_1127236629

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1127236628 1127236629
Species Human (GRCh38) Human (GRCh38)
Location 15:57059833-57059855 15:57059852-57059874
Sequence CCAGTTTTTGCTAGTGGATCAAA CAAAACCTAGAGATGCCCATAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 103} {0: 1, 1: 0, 2: 1, 3: 13, 4: 122}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!