ID: 1127267598_1127267599

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1127267598 1127267599
Species Human (GRCh38) Human (GRCh38)
Location 15:57374355-57374377 15:57374393-57374415
Sequence CCTTTCTCTCTTTCTTTTCTTTT ACAATTTCATTCTGTTGCCCAGG
Strand - +
Off-target summary {0: 8, 1: 127, 2: 1139, 3: 5295, 4: 22157} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!