ID: 1127282361_1127282375

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1127282361 1127282375
Species Human (GRCh38) Human (GRCh38)
Location 15:57503227-57503249 15:57503272-57503294
Sequence CCTTCCTCCTACTCCTGATGAGG CTCTGTGACTCATACCCAAGAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 15, 4: 274} {0: 1, 1: 0, 2: 2, 3: 11, 4: 115}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!