ID: 1127294398_1127294405

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1127294398 1127294405
Species Human (GRCh38) Human (GRCh38)
Location 15:57596964-57596986 15:57597004-57597026
Sequence CCTCCCCAGGCCTGGTGGAATAG TCTCACCAGGTCCTACGTAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 285} {0: 1, 1: 0, 2: 0, 3: 0, 4: 37}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!