ID: 1127298131_1127298134

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1127298131 1127298134
Species Human (GRCh38) Human (GRCh38)
Location 15:57627767-57627789 15:57627786-57627808
Sequence CCAGGATTAGAAAAATCCTGGTC GGTCTCTTGGACCAGAGTGTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 83} {0: 1, 1: 0, 2: 0, 3: 15, 4: 136}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!