ID: 1127299084_1127299093

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1127299084 1127299093
Species Human (GRCh38) Human (GRCh38)
Location 15:57634932-57634954 15:57634983-57635005
Sequence CCTCCCACATTATTGTCCTCCTA ATGCTCTCTCTCTGGGCAGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 149} {0: 1, 1: 0, 2: 0, 3: 23, 4: 411}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!