ID: 1127347853_1127347857

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1127347853 1127347857
Species Human (GRCh38) Human (GRCh38)
Location 15:58118914-58118936 15:58118943-58118965
Sequence CCTGCTAGTGGGGGAATGGAAGT GTGCAGGGACTTACAGAGAATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 111} {0: 1, 1: 0, 2: 1, 3: 24, 4: 196}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!