ID: 1127361014_1127361022

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1127361014 1127361022
Species Human (GRCh38) Human (GRCh38)
Location 15:58245299-58245321 15:58245319-58245341
Sequence CCAGCTCCCCATCTTCCCTGAAA AAAGCATGGACTCCAGCTTCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 43, 4: 414} {0: 1, 1: 0, 2: 1, 3: 15, 4: 166}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!