ID: 1127361458_1127361465

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1127361458 1127361465
Species Human (GRCh38) Human (GRCh38)
Location 15:58248166-58248188 15:58248200-58248222
Sequence CCTCCACAAAGCAGCACACAATG CCCCGGATGGCAGCCAGGCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 218} {0: 1, 1: 0, 2: 3, 3: 35, 4: 301}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!