ID: 1127378015_1127378019

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1127378015 1127378019
Species Human (GRCh38) Human (GRCh38)
Location 15:58402740-58402762 15:58402753-58402775
Sequence CCGTGCCCATTACTGCCATGACT TGCCATGACTGTCACATGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 206} {0: 1, 1: 0, 2: 0, 3: 15, 4: 190}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!