ID: 1127391099_1127391104

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1127391099 1127391104
Species Human (GRCh38) Human (GRCh38)
Location 15:58505803-58505825 15:58505831-58505853
Sequence CCAAAAACCATCACCTCTATCAT GAGTATCCTGCTTTCATTAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 31, 4: 291} {0: 1, 1: 0, 2: 0, 3: 16, 4: 86}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!