ID: 1127410213_1127410219

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1127410213 1127410219
Species Human (GRCh38) Human (GRCh38)
Location 15:58697751-58697773 15:58697786-58697808
Sequence CCAAGAATCAGCCCACCTGGACC TGCCAGCATATGTTGCCCTAAGG
Strand - +
Off-target summary {0: 8, 1: 10, 2: 27, 3: 76, 4: 240} {0: 1, 1: 0, 2: 7, 3: 17, 4: 96}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!