ID: 1127410214_1127410222

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1127410214 1127410222
Species Human (GRCh38) Human (GRCh38)
Location 15:58697762-58697784 15:58697798-58697820
Sequence CCCACCTGGACCTGCTAACACCA TTGCCCTAAGGCCCAAGGACAGG
Strand - +
Off-target summary {0: 4, 1: 5, 2: 28, 3: 47, 4: 200} {0: 2, 1: 0, 2: 3, 3: 27, 4: 137}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!