ID: 1127410215_1127410222

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1127410215 1127410222
Species Human (GRCh38) Human (GRCh38)
Location 15:58697763-58697785 15:58697798-58697820
Sequence CCACCTGGACCTGCTAACACCAG TTGCCCTAAGGCCCAAGGACAGG
Strand - +
Off-target summary {0: 3, 1: 3, 2: 17, 3: 35, 4: 174} {0: 2, 1: 0, 2: 3, 3: 27, 4: 137}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!