ID: 1127435873_1127435876

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1127435873 1127435876
Species Human (GRCh38) Human (GRCh38)
Location 15:58957665-58957687 15:58957691-58957713
Sequence CCATAGAGCCAATGCTTCGAGAG GAGAGAGAGAGAGACCAAGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 71} {0: 1, 1: 20, 2: 242, 3: 1436, 4: 7360}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!