|
Left Crispr |
Right Crispr |
| Crispr ID |
1127454682 |
1127454685 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
15:59146018-59146040
|
15:59146047-59146069
|
| Sequence |
CCTTATTGTTATTATTTTTAGAG |
TCTTGCTATGATGCCCAGGCTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 2, 1: 1, 2: 29, 3: 113, 4: 1115} |
{0: 43, 1: 5917, 2: 38636, 3: 101848, 4: 210627} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|